A and b dna

A and b dna DEFAULT

Transitions of Double-Stranded DNA Between the A- and B-Forms

1. Franklin RE, Gosling RG. Molecular Configuration in Sodium Thymonucleate. Nature. ;– [PubMed] [Google Scholar]

2. Watson JD, Crick FHC. A Structure for Deoxyribose Nucleic Acid. Nature. ;– [PubMed] [Google Scholar]

3. Franklin RE, Gosling RG. Evidence for 2-Chain Helix in Crystalline Structure of Sodium Deoxyribonucleate. Nature. ;– [PubMed] [Google Scholar]

4. Dickerson RE. Definitions and Nomenclature of Nucleic Acid Structure Components. Nucleic Acids Res. ;–[PMC free article] [PubMed] [Google Scholar]

5. Olson WK, Bansal M, Burley SK, Dickerson RE, Gerstein M, Harvey SC, Heinemann U, Lu XJ, Neidle S, Shakked Z, et al. A Standard Reference Frame for the Description of Nucleic Acid Base-Pair Geometry. J Mol Biol. ;– [PubMed] [Google Scholar]

6. Wang AH, Quigley GJ, Kolpak FJ, Crawford JL, van Boom JH, van der Marel G, Rich A. Molecular Structure of a Left-Handed Double-Helical DNA Fragment at Atomic Resolution. Nature. ;– [PubMed] [Google Scholar]

7. Zhang SG, Lockshin C, Herbert A, Winter E, Rich A. Zuotin, a Putative Z-DNA Binding Protein in Saccharomyces-Cerevisiae. EMBO J. ;–[PMC free article] [PubMed] [Google Scholar]

8. Kim YG, Lowenhaupt K, Oh DB, Kim KK, Rich A. Evidence That Vaccinia Virulence Factor E3l Binds to Z-DNA in Vivo: Implications for Development of a Therapy for Poxvirus Infection. Proc Natl Acad Sci U S A. ;–[PMC free article] [PubMed] [Google Scholar]

9. Kim YG, Muralinath M, Brandt T, Pearcy M, Hauns K, Lowenhaupt K, Jacobs BL, Rich A. A Role for Z-DNA Binding in Vaccinia Virus Pathogenesis. Proc Natl Acad Sci U S A. ;–[PMC free article] [PubMed] [Google Scholar]

Mohr SC, Sokolov NV, He CM, Setlow P. Binding of Small Acid-Soluble Spore Proteins from Bacillus Subtilis Changes the Conformation of DNA from B to A. Proc Natl Acad Sci U S A. ;–[PMC free article] [PubMed] [Google Scholar]

Lu XJ, Shakked Z, Olson WK. A-Form Conformational Motifs in Ligand-Bound DNA Structures. J Mol Biol. ;– [PubMed] [Google Scholar]

DiMaio F, Yu X, Rensen E, Krupovic M, Prangishvili D, Egelman EH. Virology. A Virus That Infects a Hyperthermophile Encapsidates a-Form DNA. Science. ;–[PMC free article] [PubMed] [Google Scholar]

Whelan DR, Hiscox TJ, Rood JI, Bambery KR, McNaughton D, Wood BR. Detection of an En Masse and Reversible B- to a-DNA Conformational Transition in Prokaryotes in Response to Desiccation. J R Soc, Interface. ;[PMC free article] [PubMed] [Google Scholar]

Harvey SC. The Scrunchworm Hypothesis: Transitions between a-DNA and B-DNA Provide the Driving Force for Genome Packaging in Double-Stranded DNA Bacteriophages. J Struct Biol. ;–8.[PMC free article] [PubMed] [Google Scholar]

Tolstorukov MY, Ivanov VI, Malenkov GG, Jernigan RL, Zhurkin VB. Sequence-Dependent Ba Transition in DNA Evaluated with Dimeric and Trimeric Scales. Biophys J. ;–[PMC free article] [PubMed] [Google Scholar]

Beveridge DL, Barreiro G, Byun KS, Case DA, Cheatham TE, 3rd, Dixit SB, Giudice E, Lankas F, Lavery R, Maddocks JH, et al. Molecular Dynamics Simulations of the Unique Tetranucleotide Sequences of DNA Oligonucleotides. I. Research Design and Results on D(Cpg) Steps. Biophys J. ;–[PMC free article] [PubMed] [Google Scholar]

Dixit SB, Beveridge DL, Case DA, Cheatham TE, Guidice E, Lankas F, Lavery R, Maddocks JH, Osman R, Sklenar H, et al. Molecular Dynamics Simulations of the Unique Tetranucleotide Sequences of DNA Oligonucleotides. Ii. Sequence Contact Effects on the Dynamical Structures of the 10 Unique Dinucleotide Steps. Biophys J. ;[PMC free article] [PubMed] [Google Scholar]

Lavery R, Zakrzewska K, Beveridge D, Bishop TC, Case DA, Cheatham T, 3rd, Dixit S, Jayaram B, Lankas F, Laughton C, et al. A Systematic Molecular Dynamics Study of Nearest-Neighbor Effects on Base Pair and Base Pair Step Conformations and Fluctuations in B-DNA. Nucleic Acids Res. ;–[PMC free article] [PubMed] [Google Scholar]

Pasi M, Maddocks JH, Beveridge D, Bishop TC, Case DA, Cheatham T, 3rd, Dans PD, Jayaram B, Lankas F, Laughton C, et al. Muabc: A Systematic Microsecond Molecular Dynamics Study of Tetranucleotide Sequence Effects in B-DNA. Nucleic Acids Res. ;–[PMC free article] [PubMed] [Google Scholar]

Galindo-Murillo R, Roe DR, Cheatham TE., 3rd On the Absence of Intrahelical DNA Dynamics on the Mus to Ms Timescale. Nat Commun. ;[PMC free article] [PubMed] [Google Scholar]

Galindo-Murillo R, Roe DR, Cheatham TE., 3rd Convergence and Reproducibility in Molecular Dynamics Simulations of the DNA Duplex D(Gcacgaacgaacgaacgc) Biochim Biophys Acta Gen Subj. ;–[PMC free article] [PubMed] [Google Scholar]

Jorgensen WL, Chandrasekhar J, Madura JD, Impey RW, Klein ML. Comparison of Simple Potential Functions for Simulating Liquid Water. J Chem Phys. ;–[Google Scholar]

Phillips JC, Braun R, Wang W, Gumbart J, Tajkhorshid E, Villa E, Chipot C, Skeel RD, Kale L, Schulten K. Scalable Molecular Dynamics with Namd. J Comput Chem. ;–[PMC free article] [PubMed] [Google Scholar]

Best RB, Zhu X, Shim J, Lopes PE, Mittal J, Feig M, Mackerell AD., Jr Optimization of the Additive Charmm All-Atom Protein Force Field Targeting Improved Sampling of the Backbone Phi, Psi and Side-Chain Chi(1) and Chi(1) Dihedral Angles. J Chem Theory Comput. ;–[PMC free article] [PubMed] [Google Scholar]

Hart K, Foloppe N, Baker CM, Denning EJ, Nilsson L, Mackerell AD., Jr Optimization of the Charmm Additive Force Field for DNA: Improved Treatment of the Bi/Bii Conformational Equilibrium. J Chem Theory Comput. ;–[PMC free article] [PubMed] [Google Scholar]

Ryckaert JP, Ciccotti G. Numerical Integration of the Cartesian Equations of Motion of a System with Constraints: Molecular Dynamics of N-Alkanes. J Comput Phys. ;–[Google Scholar]

Darden T, York D, Pedersen L. Particle Mesh Ewald: An N-Log(N) Method for Ewald Sums in Large Systems. J Chem Phys. ;–[Google Scholar]

Cheatham TE, Miller JL, Fox T, Darden TA, Kollman PA. Molecular Dynamics Simulations on Solvated Biomolecular Systems: The Particle Mesh Ewald Method Leads to Stable Trajectories of DNA, Rna, and Proteins. J Am Chem Soc. ;–[Google Scholar]

Zheng G, Lu XJ, Olson WK. Web 3dna&#x;a Web Server for the Analysis, Reconstruction, and Visualization of Three-Dimensional Nucleic-Acid Structures. Nucleic Acids Res. ;W–[PMC free article] [PubMed] [Google Scholar]

Altona C, Sundaralingam M. Conformational Analysis of the Sugar Ring in Nucleosides and Nucleotides. A New Description Using the Concept of Pseudorotation. J Am Chem Soc. ;– [PubMed] [Google Scholar]

Saenger W. Principles of Nucleic Acid Structure. Springer-Verlag; New York: [Google Scholar]

El Hassan MA, Calladine CR. Conformational Characteristics of DNA: Empirical Classifications and a Hypothesis for the Conformational Behaviour of Dinucleotide Steps. Philos Trans R Soc, A. ;–[Google Scholar]

Lu XJ, Olson WK. 3dna: A Software Package for the Analysis, Rebuilding and Visualization of Three-Dimensional Nucleic Acid Structures. Nucleic Acids Res. ;–[PMC free article] [PubMed] [Google Scholar]

Lu XJ, Olson WK. 3dna: A Versatile, Integrated Software System for the Analysis, Rebuilding and Visualization of Three-Dimensional Nucleic-Acid Structures. Nat Protoc. ;–[PMC free article] [PubMed] [Google Scholar]

Pearlman DA, Case DA, Caldwell JW, Ross WR, Cheatham TE, DeBolt S, Ferguson D, Seibel G, Kollman PA. Amber: A Computer Program for Applying Molecular Mechanics, Normal Mode Analysis, Molecular Dynamics and Free Energy Calculations to Elucidate the Structures and Energies of Molecules. Comput Phys Commun. ;–[Google Scholar]

Case DA, Cheatham TE, 3rd, Darden T, Gohlke H, Luo R, Merz KM, Jr, Onufriev A, Simmerling C, Wang B, Woods RJ. The Amber Biomolecular Simulation Programs. J Comput Chem. ;–[PMC free article] [PubMed] [Google Scholar]

Cheatham TE, 3rd, Cieplak P, Kollman PA. A Modified Version of the Cornell Et Al. Force Field with Improved Sugar Pucker Phases and Helical Repeat. J Biomol Struct Dyn. ;– [PubMed] [Google Scholar]

Perez A, Luque FJ, Orozco M. Dynamics of B-DNA on the Microsecond Time Scale. J Am Chem Soc. ;– [PubMed] [Google Scholar]

Berendsen HJC, Grigera JR. The Missing Term in Effective Pair Potentials. J Phys Chem. ;–[Google Scholar]

Dickerson RE, Drew HR. Structure of a B-DNA Dodecamer. Ii. Influence of Base Sequence on Helix Structure. J Mol Biol. ;– [PubMed] [Google Scholar]

Moffitt JR, Chemla YR, Aathavan K, Grimes S, Jardine PJ, Anderson DL, Bustamante C. Intersubunit Coordination in a Homomeric Ring Atpase. Nature. ;–[PMC free article] [PubMed] [Google Scholar]

Chistol G, Liu S, Hetherington CL, Moffitt JR, Grimes S, Jardine PJ, Bustamante C. High Degree of Coordination and Division of Labor among Subunits in a Homomeric Ring Atpase. Cell. ;–[PMC free article] [PubMed] [Google Scholar]

Liu S, Chistol G, Hetherington CL, Tafoya S, Aathavan K, Schnitzbauer J, Grimes S, Jardine PJ, Bustamante C. A Viral Packaging Motor Varies Its DNA Rotation and Step Size to Preserve Subunit Coordination as the Capsid Fills. Cell. ;–[PMC free article] [PubMed] [Google Scholar]

Wang JC. Helical Repeat of DNA in Solution. Proc Natl Acad Sci U S A. ;–[PMC free article] [PubMed] [Google Scholar]

Blanchet C, Pasi M, Zakrzewska K, Lavery R. Curves+ Web Server for Analyzing and Visualizing the Helical, Backbone and Groove Parameters of Nucleic Acid Structures. Nucleic Acids Res. ;W68–[PMC free article] [PubMed] [Google Scholar]

Lavery R, Sklenar H. The Definition of Generalized Helicoidal Parameters and of Axis Curvature for Irregular Nucleic Acids. J Biomol Struct Dyn. ;– [PubMed] [Google Scholar]

Jayaram B, Sprous D, Young MA, Beveridge DL. Free Energy Analysis of the Conformational Preferences of a and B Forms of DNA in Solution. J Am Chem Soc. ;–[Google Scholar]

Sours: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC/

A-DNA

A-DNA is one of the possible double helical structures which DNA can adopt. A-DNA is thought to be one of three biologically active double helical structures along with B-DNA and Z-DNA. It is a right-handed double helix fairly similar to the more common B-DNA form, but with a shorter, more compact helical structure whose base pairs are not perpendicular to the helix-axis as in B-DNA. It was discovered by Rosalind Franklin, who also named the A and B forms. She showed that DNA is driven into the A form when under dehydrating conditions. Such conditions are commonly used to form crystals, and many DNA crystal structures are in the A form.[1] The same helical conformation occurs in double-stranded RNAs, and in DNA-RNA hybrid double helices.

Structure[edit]

A-DNA is fairly similar to B-DNA given that it is a right-handed double helix with major and minor grooves. However, as shown in the comparison table below, there is a slight increase in the number of base pairs (bp) per turn (resulting in a smaller twist angle), and smaller rise per base pair (making A-DNA % shorter than B-DNA). The major groove of A-DNA is deep and narrow, while the minor groove is wide and shallow. A-DNA is broader and apparently more compressed along its axis than B-DNA.[2]

Comparison geometries of the most common DNA forms[edit]

Side and top view of A-, B-, and Z-DNA conformations.
Yellow dots represent the location of the helical axis of A-, B-, and Z-DNA with respect to a Guanine-Cytosine base pair.
Geometry attribute: A-formB-formZ-form
Helix senseright-handedright-handedleft-handed
Repeating unit1 bp1 bp2 bp
Rotation/bp°°60°/2
Mean bp/turn111012
Inclination of bp to axis+19°−°−9°
Rise/bp along axis Å (&#;nm) Å (&#;nm) Å (&#;nm)
Rise/turn of helix Å (&#;nm) Å (&#;nm) Å (&#;nm)
Mean propeller twist+18°+16°
Glycosyl angleantiantipyrimidine: anti,
purine: syn
Nucleotide phosphate to phosphate distance Å ÅC: Å,
G: Å
Sugar puckerC3'-endoC2'-endoC: C2'-endo,
G: C3'-endo
Diameter23 Å (&#;nm)20 Å (&#;nm)18 Å (&#;nm)

Biological function[edit]

Dehydration of DNA drives it into the A form, and this apparently protects DNA under conditions such as the extreme desiccation of bacteria.[3] Protein binding can also strip solvent off of DNA and convert it to the A form, as revealed by the structure of several hyperthermophilic archaeal viruses, including rod-shaped rudiviruses SIRV2 [4] and SSRV1,[5] enveloped filamentous lipothrixviruses AFV1,[6] SFV1 [7] and SIFV,[5]tristromavirus PFV2 [8] as well as icosahedral portoglobovirus SPV1.[9] A-form DNA is believed to be one of the adaptations of hyperthermophilic archaeal viruses to harsh environmental conditions in which these viruses thrive.

It has been proposed that the motors that package double-stranded DNA in bacteriophages exploit the fact that A-DNA is shorter than B-DNA, and that conformational changes in the DNA itself are the source of the large forces generated by these motors.[10] Experimental evidence for A-DNA as an intermediate in viral biomotor packing comes from double dye Förster resonance energy transfer measurements showing that B-DNA is shortened by 24% in a stalled ("crunched") A-form intermediate.[11][12] In this model, ATP hydrolysis is used to drive protein conformational changes that alternatively dehydrate and rehydrate the DNA, and the DNA shortening/lengthening cycle is coupled to a protein-DNA grip/release cycle to generate the forward motion that moves DNA into the capsid.

See also[edit]

References[edit]

  1. ^Rosalind, Franklin (). "The Structure of Sodium Thymonucleate Fibres. I. The Influence of Water Content"(PDF). Acta Crystallographica. 6 (8): – doi/sx
  2. ^Dickerson, Richard E. (). "DNA structure from a to Z". DNA Structures Part A: Synthesis and Physical Analysis of DNA. Methods in Enzymology. . pp.&#;67– doi/(92) ISBN&#;. PMID&#;
  3. ^Whelan DR, et&#;al. (). "Detection of an en masse and reversible B- to A-DNA conformational transition in prokaryotes in response to desiccation". J R Soc Interface. 11 (97): doi/rsif PMC&#; PMID&#;
  4. ^Di Maio F, Egelman EH, et&#;al. (). "A virus that infects a hyperthermophile encapsidates A-form DNA". Science. (): – BibcodeSciD. doi/science.aaa PMC&#; PMID&#;
  5. ^ abWang, F; Baquero, DP; Beltran, LC; Su, Z; Osinski, T; Zheng, W; Prangishvili, D; Krupovic, M; Egelman, EH (5 August ). "Structures of filamentous viruses infecting hyperthermophilic archaea explain DNA stabilization in extreme environments". Proceedings of the National Academy of Sciences of the United States of America. (33): – doi/pnas PMC&#; PMID&#;
  6. ^Kasson, P; DiMaio, F; Yu, X; Lucas-Staat, S; Krupovic, M; Schouten, S; Prangishvili, D; Egelman, EH (). "Model for a novel membrane envelope in a filamentous hyperthermophilic virus". eLife. 6: e doi/eLife PMC&#; PMID&#;
  7. ^Liu, Y; Osinski, T; Wang, F; Krupovic, M; Schouten, S; Kasson, P; Prangishvili, D; Egelman, EH (). "Structural conservation in a membrane-enveloped filamentous virus infecting a hyperthermophilic acidophile". Nature Communications. 9 (1): BibcodeNatCoL. doi/s PMC&#; PMID&#;
  8. ^Wang, F; Baquero, DP; Su, Z; Osinski, T; Prangishvili, D; Egelman, EH; Krupovic, M (). "Structure of a filamentous virus uncovers familial ties within the archaeal virosphere". Virus Evolution. 6 (1): veaa doi/ve/veaa PMC&#; PMID&#;
  9. ^Wang, F; Liu, Y; Su, Z; Osinski, T; de Oliveira, GAP; Conway, JF; Schouten, S; Krupovic, M; Prangishvili, D; Egelman, EH (). "A packing for A-form DNA in an icosahedral virus". Proceedings of the National Academy of Sciences of the United States of America. (45): – doi/pnas PMC&#; PMID&#;
  10. ^Harvey, SC (). "The scrunchworm hypothesis: Transitions between A-DNA and B-DNA provide the driving force for genome packaging in double-stranded DNA bacteriophages". Journal of Structural Biology. (1): 1–8. doi/j.jsb PMC&#; PMID&#;
  11. ^Oram, M (). "Modulation of the packaging reaction of bacteriophage t4 terminase by DNA structure". J Mol Biol. (1): 61– doi/j.jmb PMC&#; PMID&#;
  12. ^Ray, K (). "DNA crunching by a viral packaging motor: Compression of a procapsid-portal stalled Y-DNA substrate". Virology. (2): – doi/j.virol PMC&#; PMID&#;

External links[edit]

Sours: https://en.wikipedia.org/wiki/A-DNA
  1. Malibu motorcycle works reviews
  2. Senior picture ideas country
  3. Roblox speed run games
  4. Psalm 91 nkjv

B-Form, A-Form, and Z-Form of DNA

  1. Last updated
  2. Save as PDF

Three major forms of DNA are double stranded and connected by interactions between complementary base pairs. These are terms A-form, B-form,and Z-form DNA.

B-form DNA

The information from the base composition of DNA, the knowledge of dinucleotide structure, and the insight that the X&#;ray crystallography suggested a helical periodicity were combined by Watson and Crick in in their proposed model for a double helical structure for DNA. They proposed two strands of DNA -- each in a right&#;hand helix -- wound around the same axis. The two strands are held together by H&#;bonding between the bases (in anti conformation) as shown in Figure \(\PageIndex{1}\).

Major groove Major groove

px-Base_pair_AT.svg.pngpx-Base_pair_GC.svg.png

Minor groove Minor groove

Figure \(\PageIndex{1}\): (left) An A:T base pair and (right) a G:C base pair

Bases fit in the double helical model if pyrimidine on one strand is always paired with purine on the other. From Chargaff's rules, the two strands will pair A with T and G with C. This pairs a keto base with an amino base, a purine with a pyrimidine. Two H&#;bonds can form between A and T, and three can form between G and C. This third H-bond in the G:C base pair is between the additional exocyclic amino group on G and the C2 keto group on C. The pyrimidine C2 keto group is not involved in hydrogen bonding in the A:T base pair.

These are the complementary base pairs. The base&#;pairing scheme immediately suggests a way to replicate and copy the the genetic information.

imagepng

The two strands are not in a simple side&#;by&#;side arrangement, which would be called a paranemic joint (Figure \(\PageIndex{3}\)). (This will be encountered during recombination in Chapter 8.) Rather the two strands are coiled around the same helical axis and are intertwined with themselves (which is referred to as a plectonemic coil). One consequence of this intertwining is that the two strands cannot be separated without the DNA rotating, one turn of the DNA for every "untwisting" of the two strands.

imagepng

Dimensions of B-form (the most common) of DNA

  • nm between bp, nm per turn, about 10 bp per turn
  • nm (about nm or 20 Angstroms) in diameter

Major and minor groove

The major groove is wider than the minor groove in DNA (Figure \(\PageIndex{2d}\)), and many sequence specific proteins interact in the major groove. The N7 and C6 groups of purines and the C4 and C5 groups of pyrimidines face into the major groove, thus they can make specific contacts with amino acids in DNA-binding proteins. Thus specific amino acids serve as H&#;bond donors and acceptors to form H-bonds with specific nucleotides in the DNA. H&#;bond donors and acceptors are also in the minor groove, and indeed some proteins bind specifically in the minor groove. Base pairs stack, with some rotation between them.

A&#;form nucleic acids and Z&#;DNA

Three different forms of duplex nucleic acid have been described. The most common form, present in most DNA at neutral pH and physiological salt concentrations, is B-form. That is the classic, right-handed double helical structure we have been discussing. A thicker right-handed duplex with a shorter distance between the base pairs has been described for RNA-DNA duplexes and RNA-RNA duplexes. This is called A-form nucleic acid.

A third form of duplex DNA has a strikingly different, left-handed helical structure. This Z DNA is formed by stretches of alternating purines and pyrimidines, e.g. GCGCGC, especially in negatively supercoiled DNA. A small amount of the DNA in a cell exists in the Z form. It has been tantalizing to propose that this different structure is involved in some way in regulation of some cellular function, such as transcription or regulation, but conclusive evidence for or against this proposal is not available yet.

Differences between A-form and B-form nucleic acid

The major difference between A-form and B-form nucleic acid is in the conformation of the deoxyribose sugar ring. It is in the C2' endoconformation for B-form, whereas it is in the C3' endoconformation in A-form. As shown in Figure \(\PageIndex{4}\), if you consider the plane defined by the C4'-O-C1' atoms of the deoxyribose, in the C2' endoconformation, the C2' atom is above the plane, whereas the C3' atom is above the plane in the C3' endoconformation. The latter conformation brings the 5' and 3' hydroxyls (both esterified to the phosphates linking to the next nucleotides) closer together than is seen in the C2' endoconfromation (Figure ). Thus the distance between adjacent nucleotides is reduced by about 1 Angstrom in A-form relative to B-form nucleic acid (Figure \(\PageIndex{4}\)).

imagepng

A second major difference between A-form and B-form nucleic acid is the placement of base-pairs within the duplex. In B-form, the base-pairs are almost centered over the helical axis (Figure \(\PageIndex{4}\)), but in A-form, they are displaced away from the central axis and closer to the major groove. The result is a ribbon-like helix with a more open cylindrical core in A-form.

Z-form DNA

Z-DNA is a radically different duplex structure, with the two strands coiling in left-handed helices and a pronounced zig-zag (hence the name) pattern in the phosphodiester backbone. As previously mentioned, Z-DNA can form when the DNA is in an alternating purine-pyrimidine sequence such as GCGCGC, and indeed the G and C nucleotides are in different conformations, leading to the zig-zag pattern. The big difference is at the G nucleotide. It has the sugar in the C3' endoconformation (like A-form nucleic acid, and in contrast to B-form DNA) and the guanine base is in the synconformation. This places the guanine back over the sugar ring, in contrast to the usual anticonformation seen in A- and B-form nucleic acid. Note that having the base in the anticonformation places it in the position where it can readily form H-bonds with the complementary base on the opposite strand. The duplex in Z-DNA has to accomodate the distortion of this G nucleotide in the synconformation. The cytosine in the adjacent nucleotide of Z-DNA is in the "normal" C2' endo, anticonformation.

px-Dnaconformations.png

Even classic B-DNA is not completely uniform in its structure. X-ray diffraction analysis of crystals of duplex oligonucleotides shows that a given sequence will adopt a distinctive structure. These variations in B-DNA may differ in the propeller twist (between bases within a pair) to optimize base stacking, or in the 3 ways that 2 successive base pairs can move relative to each other: twist, roll, or slide.

B-FormA-FormZ-Form
helix senseRight HandedRight HandedLeft Handed
base pairs per turn101112
vertical rise per bp Å Å19 Å
rotation per bp+36°+33°°
helical diameter 19 Å19 Å19 Å
Sours: https://bio.libretexts.org/Bookshelves/Genetics/Book%3A_Working_with_Molecular_Genetics_(Hardison)/Unit_I%3A_Genes_Nucleic_Acids_Genomes_and_Chromosomes/2%3A_Structures_of_Nucleic_Acids/%3A_B-Form_A-Form_and_Z-Form_of_DNA

Nucleic acid double helix

Structure formed by double-stranded molecules

"Double helix" redirects here. For other uses, see Double helix (disambiguation).

Two complementaryregions of nucleic acid molecules will bind and form a double helical structure held together by base pairs.

In molecular biology, the term double helix[1] refers to the structure formed by double-stranded molecules of nucleic acids such as DNA. The double helical structure of a nucleic acid complex arises as a consequence of its secondary structure, and is a fundamental component in determining its tertiary structure. The term entered popular culture with the publication in of The Double Helix: A Personal Account of the Discovery of the Structure of DNA by James Watson.

The DNA double helix biopolymer of nucleic acid is held together by nucleotides which base pair together.[2] In B-DNA, the most common double helical structure found in nature, the double helix is right-handed with about 10&#; base pairs per turn.[3] The double helix structure of DNA contains a major groove and minor groove. In B-DNA the major groove is wider than the minor groove.[2] Given the difference in widths of the major groove and minor groove, many proteins which bind to B-DNA do so through the wider major groove.[4]

History[edit]

Further information: History of molecular biology

The double-helix model of DNA structure was first published in the journal Nature by James Watson and Francis Crick in ,[5] (X,Y,Z coordinates in [6]) based on the work of Rosalind Franklin and her student Raymond Gosling, who took the crucial X-ray diffraction image of DNA labeled as "Photo 51", [7][8] and Maurice Wilkins, Alexander Stokes, and Herbert Wilson,[9] and base-pairing chemical and biochemical information by Erwin Chargaff.[10][11][12][13][14][15] The prior model was triple-stranded DNA.[16]

The realization that the structure of DNA is that of a double-helix elucidated the mechanism of base pairing by which genetic information is stored and copied in living organisms and is widely considered one of the most important scientific discoveries of the 20th century. Crick, Wilkins, and Watson each received one third of the Nobel Prize in Physiology or Medicine for their contributions to the discovery.[17]

Nucleic acid hybridization[edit]

Main article: Nucleic acid thermodynamics

Hybridization is the process of complementarybase pairs binding to form a double helix. Melting is the process by which the interactions between the strands of the double helix are broken, separating the two nucleic acid strands. These bonds are weak, easily separated by gentle heating, enzymes, or mechanical force. Melting occurs preferentially at certain points in the nucleic acid.[18]T and A rich regions are more easily melted than C and G rich regions. Some base steps (pairs) are also susceptible to DNA melting, such as T A and T G.[19] These mechanical features are reflected by the use of sequences such as TATA at the start of many genes to assist RNA polymerase in melting the DNA for transcription.

Strand separation by gentle heating, as used in polymerase chain reaction (PCR), is simple, providing the molecules have fewer than about 10, base pairs (10 kilobase pairs, or 10 kbp). The intertwining of the DNA strands makes long segments difficult to separate. The cell avoids this problem by allowing its DNA-melting enzymes (helicases) to work concurrently with topoisomerases, which can chemically cleave the phosphate backbone of one of the strands so that it can swivel around the other. Helicases unwind the strands to facilitate the advance of sequence-reading enzymes such as DNA polymerase.

Base pair geometry[edit]

The geometry of a base, or base pair step can be characterized by 6 coordinates: shift, slide, rise, tilt, roll, and twist. These values precisely define the location and orientation in space of every base or base pair in a nucleic acid molecule relative to its predecessor along the axis of the helix. Together, they characterize the helical structure of the molecule. In regions of DNA or RNA where the normal structure is disrupted, the change in these values can be used to describe such disruption.

For each base pair, considered relative to its predecessor, there are the following base pair geometries to consider:[20][21][22]

  • Shear
  • Stretch
  • Stagger
  • Buckle
  • Propeller: rotation of one base with respect to the other in the same base pair.
  • Opening
  • Shift: displacement along an axis in the base-pair plane perpendicular to the first, directed from the minor to the major groove.
  • Slide: displacement along an axis in the plane of the base pair directed from one strand to the other.
  • Rise: displacement along the helix axis.
  • Tilt: rotation around the shift axis.
  • Roll: rotation around the slide axis.
  • Twist: rotation around the rise axis.
  • x-displacement
  • y-displacement
  • inclination
  • tip
  • pitch: the height per complete turn of the helix.

Rise and twist determine the handedness and pitch of the helix. The other coordinates, by contrast, can be zero. Slide and shift are typically small in B-DNA, but are substantial in A- and Z-DNA. Roll and tilt make successive base pairs less parallel, and are typically small.

Note that "tilt" has often been used differently in the scientific literature, referring to the deviation of the first, inter-strand base-pair axis from perpendicularity to the helix axis. This corresponds to slide between a succession of base pairs, and in helix-based coordinates is properly termed "inclination".

Helix geometries[edit]

At least three DNA conformations are believed to be found in nature, A-DNA, B-DNA, and Z-DNA. The B form described by James Watson and Francis Crick is believed to predominate in cells.[23] It is Å wide and extends 34 Å per 10 bp of sequence. The double helix makes one complete turn about its axis every – base pairs in solution. This frequency of twist (termed the helical pitch) depends largely on stacking forces that each base exerts on its neighbours in the chain. The absolute configuration of the bases determines the direction of the helical curve for a given conformation.

A-DNA and Z-DNA differ significantly in their geometry and dimensions to B-DNA, although still form helical structures. It was long thought that the A form only occurs in dehydrated samples of DNA in the laboratory, such as those used in crystallographic experiments, and in hybrid pairings of DNA and RNA strands, but DNA dehydration does occur in vivo, and A-DNA is now known to have biological functions. Segments of DNA that cells have methylated for regulatory purposes may adopt the Z geometry, in which the strands turn about the helical axis the opposite way to A-DNA and B-DNA. There is also evidence of protein-DNA complexes forming Z-DNA structures.

See also: Nucleic acid tertiary structure

Other conformations are possible; A-DNA, B-DNA, C-DNA, E-DNA,[24]L-DNA (the enantiomeric form of D-DNA),[25] P-DNA,[26] S-DNA, Z-DNA, etc. have been described so far.[27] In fact, only the letters F, Q, U, V, and Y are now[update] available to describe any new DNA structure that may appear in the future.[28][29] However, most of these forms have been created synthetically and have not been observed in naturally occurring biological systems.[citation needed] There are also triple-stranded DNA forms and quadruplex forms such as the G-quadruplex and the i-motif.

The structures of A-, B-, and Z-DNA.
The helix axis of A-, B-, and Z-DNA.
Geometry attribute A-DNA B-DNA Z-DNA
Helix senseright-handedright-handedleft-handed
Repeating unit1 bp1 bp2 bp
Rotation/bp°°60°/2
bp/turn1112
Inclination of bp to axis+19°−°−9°
Rise/bp along axis Å (&#;nm) Å (&#;nm) Å (&#;nm)
Pitch/turn of helix Å (&#;nm) Å (&#;nm) Å (&#;nm)
Mean propeller twist+18°+16°
Glycosyl angleantiantiC: anti,
G: syn
Sugar puckerC3'-endoC2'-endoC: C2'-endo,
G: C2'-exo
Diameter23 Å (&#;nm)20 Å (&#;nm)18 Å (&#;nm)

Grooves[edit]

Major and minor grooves of DNA. Minor groove is a binding site for the dye Hoechst

Twin helical strands form the DNA backbone. Another double helix may be found by tracing the spaces, or grooves, between the strands. These voids are adjacent to the base pairs and may provide a binding site. As the strands are not directly opposite each other, the grooves are unequally sized. One groove, the major groove, is 22&#;Å wide and the other, the minor groove, is 12&#;Å wide.[33] The narrowness of the minor groove means that the edges of the bases are more accessible in the major groove. As a result, proteins like transcription factors that can bind to specific sequences in double-stranded DNA usually make contacts to the sides of the bases exposed in the major groove.[4] This situation varies in unusual conformations of DNA within the cell (see below), but the major and minor grooves are always named to reflect the differences in size that would be seen if the DNA is twisted back into the ordinary B form.

Non-double helical forms[edit]

Alternative non-helical models were briefly considered in the late s as a potential solution to problems in DNA replication in plasmids and chromatin. However, the models were set aside in favor of the double-helical model due to subsequent experimental advances such as X-ray crystallography of DNA duplexes and later the nucleosome core particle, and the discovery of topoisomerases. Also, the non-double-helical models are not currently accepted by the mainstream scientific community.[34][35]

Bending[edit]

DNA is a relatively rigid polymer, typically modelled as a worm-like chain. It has three significant degrees of freedom; bending, twisting, and compression, each of which cause certain limits on what is possible with DNA within a cell. Twisting-torsional stiffness is important for the circularisation of DNA and the orientation of DNA bound proteins relative to each other and bending-axial stiffness is important for DNA wrapping and circularisation and protein interactions. Compression-extension is relatively unimportant in the absence of high tension.

Persistence length, axial stiffness[edit]

Main article: Persistence length

Sequence Persistence length
/ base pairs
Random ±10
(CA)repeat±10
(CAG)repeat±10
(TATA)repeat±10

DNA in solution does not take a rigid structure but is continually changing conformation due to thermal vibration and collisions with water molecules, which makes classical measures of rigidity impossible to apply. Hence, the bending stiffness of DNA is measured by the persistence length, defined as:

The length of DNA over which the time-averaged orientation of the polymer becomes uncorrelated by a factor of e.[citation needed]

This value may be directly measured using an atomic force microscope to directly image DNA molecules of various lengths. In an aqueous solution, the average persistence length is 46–50&#;nm or – base pairs (the diameter of DNA is 2&#;nm), although can vary significantly. This makes DNA a moderately stiff molecule.

The persistence length of a section of DNA is somewhat dependent on its sequence, and this can cause significant variation. The variation is largely due to base stacking energies and the residues which extend into the minor and major grooves.

Models for DNA bending[edit]

Step Stacking ΔG
/kcal mol−1
T A
T G or C A
C G
A G or C T
A A or T T
A T
G A or T C
C C or G G
A C or G T
G C

At length-scales larger than the persistence length, the entropic flexibility of DNA is remarkably consistent with standard polymer physics models, such as the Kratky-Porodworm-like chain model.[37] Consistent with the worm-like chain model is the observation that bending DNA is also described by Hooke's law at very small (sub-piconewton) forces. For DNA segments less than the persistence length, the bending force is approximately constant and behaviour deviates from the worm-like chain predictions.

This effect results in unusual ease in circularising small DNA molecules and a higher probability of finding highly bent sections of DNA.[38]

Bending preference[edit]

DNA molecules often have a preferred direction to bend, i.e., anisotropic bending. This is, again, due to the properties of the bases which make up the DNA sequence - a random sequence will have no preferred bend direction, i.e., isotropic bending.

Preferred DNA bend direction is determined by the stability of stacking each base on top of the next. If unstable base stacking steps are always found on one side of the DNA helix then the DNA will preferentially bend away from that direction. As bend angle increases then steric hindrances and ability to roll the residues relative to each other also play a role, especially in the minor groove. A and T residues will be preferentially be found in the minor grooves on the inside of bends. This effect is particularly seen in DNA-protein binding where tight DNA bending is induced, such as in nucleosome particles. See base step distortions above.

DNA molecules with exceptional bending preference can become intrinsically bent. This was first observed in trypanosomatidkinetoplast DNA. Typical sequences which cause this contain stretches of T and A residues separated by G and C rich sections which keep the A and T residues in phase with the minor groove on one side of the molecule. For example:

¦¦¦¦¦¦
GATTCCCAAAAATGTCAAAAAATAGGCAAAAAATGCCAAAAAATCCCAAAC

The intrinsically bent structure is induced by the 'propeller twist' of base pairs relative to each other allowing unusual bifurcated Hydrogen-bonds between base steps. At higher temperatures this structure is denatured, and so the intrinsic bend is lost.

All DNA which bends anisotropically has, on average, a longer persistence length and greater axial stiffness. This increased rigidity is required to prevent random bending which would make the molecule act isotropically.

Circularization[edit]

DNA circularization depends on both the axial (bending) stiffness and torsional (rotational) stiffness of the molecule. For a DNA molecule to successfully circularize it must be long enough to easily bend into the full circle and must have the correct number of bases so the ends are in the correct rotation to allow bonding to occur. The optimum length for circularization of DNA is around base pairs (&#;nm)[citation needed], with an integral number of turns of the DNA helix, i.e., multiples of base pairs. Having a non integral number of turns presents a significant energy barrier for circularization, for example a x 30 = base pair molecule will circularize hundreds of times faster than x ≈ base pair molecule.[39]

The bending of short circularized DNA segments is non-uniform. Rather, for circularized DNA segments less than the persistence length, DNA bending is localised to kinks that form preferentially in AT-rich segments. If a nick is present, bending will be localised to the nick site.[38]

Stretching[edit]

Elastic stretching regime[edit]

Longer stretches of DNA are entropically elastic under tension. When DNA is in solution, it undergoes continuous structural variations due to the energy available in the thermal bath of the solvent. This is due to the thermal vibration of the molecule combined with continual collisions with water molecules. For entropic reasons, more compact relaxed states are thermally accessible than stretched out states, and so DNA molecules are almost universally found in a tangled relaxed layouts. For this reason, one molecule of DNA will stretch under a force, straightening it out. Using optical tweezers, the entropic stretching behavior of DNA has been studied and analyzed from a polymer physics perspective, and it has been found that DNA behaves largely like the Kratky-Porodworm-like chain model under physiologically accessible energy scales.

Phase transitions under stretching[edit]

Under sufficient tension and positive torque, DNA is thought to undergo a phase transition with the bases splaying outwards and the phosphates moving to the middle. This proposed structure for overstretched DNA has been called P-form DNA, in honor of Linus Pauling who originally presented it as a possible structure of DNA.[26]

Evidence from mechanical stretching of DNA in the absence of imposed torque points to a transition or transitions leading to further structures which are generally referred to as S-form DNA. These structures have not yet been definitively characterised due to the difficulty of carrying out atomic-resolution imaging in solution while under applied force although many computer simulation studies have been made (for example,[40][41]).

Proposed S-DNA structures include those which preserve base-pair stacking and hydrogen bonding (GC-rich), while releasing extension by tilting, as well as structures in which partial melting of the base-stack takes place, while base-base association is nonetheless overall preserved (AT-rich).

Periodic fracture of the base-pair stack with a break occurring once per three bp (therefore one out of every three bp-bp steps) has been proposed as a regular structure which preserves planarity of the base-stacking and releases the appropriate amount of extension,[42] with the term "Σ-DNA" introduced as a mnemonic, with the three right-facing points of the Sigma character serving as a reminder of the three grouped base pairs. The Σ form has been shown to have a sequence preference for GNC motifs which are believed under the GNC hypothesis to be of evolutionary importance.[43]

Supercoiling and topology[edit]

Main article: DNA supercoil

Supercoiled structure of circular DNA molecules with low writhe. The helical aspect of the DNA duplex is omitted for clarity.

The B form of the DNA helix twists ° per bp in the absence of torsional strain. But many molecular biological processes can induce torsional strain. A DNA segment with excess or insufficient helical twisting is referred to, respectively, as positively or negatively supercoiled. DNA in vivo is typically negatively supercoiled, which facilitates the unwinding (melting) of the double-helix required for RNA transcription.

Within the cell most DNA is topologically restricted. DNA is typically found in closed loops (such as plasmids in prokaryotes) which are topologically closed, or as very long molecules whose diffusion coefficients produce effectively topologically closed domains. Linear sections of DNA are also commonly bound to proteins or physical structures (such as membranes) to form closed topological loops.

Francis Crick was one of the first to propose the importance of linking numbers when considering DNA supercoils. In a paper published in , Crick outlined the problem as follows:

In considering supercoils formed by closed double-stranded molecules of DNA certain mathematical concepts, such as the linking number and the twist, are needed. The meaning of these for a closed ribbon is explained and also that of the writhing number of a closed curve. Some simple examples are given, some of which may be relevant to the structure of chromatin.[44]

Analysis of DNA topology uses three values:

  • L = linking number - the number of times one DNA strand wraps around the other. It is an integer for a closed loop and constant for a closed topological domain.
  • T = twist - total number of turns in the double stranded DNA helix. This will normally tend to approach the number of turns that a topologically open double stranded DNA helix makes free in solution: number of bases/, assuming there are no intercalating agents (e.g., ethidium bromide) or other elements modifying the stiffness of the DNA.
  • W = writhe - number of turns of the double stranded DNA helix around the superhelical axis
  • L = T + W and ΔL = ΔT + ΔW

Any change of T in a closed topological domain must be balanced by a change in W, and vice versa. This results in higher order structure of DNA. A circular DNA molecule with a writhe of 0 will be circular. If the twist of this molecule is subsequently increased or decreased by supercoiling then the writhe will be appropriately altered, making the molecule undergo plectonemic or toroidal superhelical coiling.

When the ends of a piece of double stranded helical DNA are joined so that it forms a circle the strands are topologically knotted. This means the single strands cannot be separated any process that does not involve breaking a strand (such as heating). The task of un-knotting topologically linked strands of DNA falls to enzymes termed topoisomerases. These enzymes are dedicated to un-knotting circular DNA by cleaving one or both strands so that another double or single stranded segment can pass through. This un-knotting is required for the replication of circular DNA and various types of recombination in linear DNA which have similar topological constraints.

The linking number paradox[edit]

For many years, the origin of residual supercoiling in eukaryotic genomes remained unclear. This topological puzzle was referred to by some as the "linking number paradox".[45] However, when experimentally determined structures of the nucleosome displayed an over-twisted left-handed wrap of DNA around the histone octamer,[46][47] this paradox was considered to be solved by the scientific community.

See also[edit]

References[edit]

  1. ^Kabai, Sándor (). "Double Helix". The Wolfram Demonstrations Project.
  2. ^ abAlberts; et&#;al. (). The Molecular Biology of the Cell. New York: Garland Science. ISBN&#;.
  3. ^Wang JC (). "Helical repeat of DNA in solution". PNAS. 76 (1): – BibcodePNASW. doi/pnas PMC&#; PMID&#;
  4. ^ abPabo C, Sauer R (). "Protein-DNA recognition". Annu Rev Biochem. 53: – doi/annurev.bi PMID&#;
  5. ^James Watson and Francis Crick (). "A structure for deoxyribose nucleic acid"(PDF). Nature. (): – BibcodeNaturW. doi/a0. PMID&#; S2CID&#;
  6. ^Crick F, Watson JD (). "The Complementary Structure of Deoxyribonucleic Acid". Proceedings of the Royal Society of London. , Series A (): 80– BibcodeRSPSAC. doi/rspa
  7. ^"Due credit". Nature. (): 18 April doi/a. PMID&#;
  8. ^Witkowski J (). "The forgotten scientists who paved the way to the double helix". Nature. (): – BibcodeNaturW. doi/d
  9. ^Wilkins MH, Stokes AR, Wilson HR (). "Molecular Structure of Deoxypentose Nucleic Acids"(PDF). Nature. (): – BibcodeNaturW. doi/a0. PMID&#; S2CID&#;
  10. ^Elson D, Chargaff E (). "On the deoxyribonucleic acid content of sea urchin gametes". Experientia. 8 (4): – doi/BF PMID&#; S2CID&#;
  11. ^Chargaff E, Lipshitz R, Green C (). "Composition of the deoxypentose nucleic acids of four genera of sea-urchin". J Biol Chem. (1): – doi/S(19) PMID&#;
  12. ^Chargaff E, Lipshitz R, Green C, Hodes ME (). "The composition of the deoxyribonucleic acid of salmon sperm". J Biol Chem. (1): – doi/S(18)X. PMID&#;
  13. ^Chargaff E (). "Some recent studies on the composition and structure of nucleic acids". J Cell Physiol Suppl. 38 (Suppl).
  14. ^Magasanik B, Vischer E, Doniger R, Elson D, Chargaff E (). "The separation and estimation of ribonucleotides in minute quantities". J Biol Chem. (1): 37– doi/S(18) PMID&#;
  15. ^Chargaff E (). "Chemical specificity of nucleic acids and mechanism of their enzymatic degradation". Experientia. 6 (6): – doi/BF PMID&#; S2CID&#;
  16. ^Pauling L, Corey RB (Feb ). "A proposed structure for the nucleic acids". Proc Natl Acad Sci U S A. 39 (2): 84– BibcodePNASP. doi/pnas PMC&#; PMID&#;
  17. ^"Nobel Prize - List of All Nobel Laureates".
  18. ^Breslauer KJ, Frank R, Blöcker H, Marky LA (). "Predicting DNA duplex stability from the base sequence". PNAS. 83 (11): – BibcodePNASB. doi/pnas PMC&#; PMID&#;
  19. ^Owczarzy, Richard (). "DNA melting temperature - How to calculate it?". High-throughput DNA biophysics. owczarzy.net. Retrieved
  20. ^Dickerson RE (). "Definitions and nomenclature of nucleic acid structure components". Nucleic Acids Res. 17 (5): – doi/nar/ PMC&#; PMID&#;
  21. ^Lu XJ, Olson WK (). "Resolving the discrepancies among nucleic acid conformational analyses". J Mol Biol. (4): – doi/jmbi PMID&#;
  22. ^Olson WK, Bansal M, Burley SK, Dickerson RE, Gerstein M, Harvey SC, Heinemann U, Lu XJ, Neidle S, Shakked Z, Sklenar H, Suzuki M, Tung CS, Westhof E, Wolberger C, Berman HM (). "A standard reference frame for the description of nucleic acid base-pair geometry". J Mol Biol. (1): – doi/jmbi PMID&#;
  23. ^Richmond; Davey, CA; et&#;al. (). "The structure of DNA in the nucleosome core". Nature. (): – BibcodeNaturR. doi/nature PMID&#; S2CID&#;
  24. ^Vargason JM, Eichman BF, Ho PS (). "The extended and eccentric E-DNA structure induced by cytosine methylation or bromination". Nature Structural Biology. 7 (9): – doi/ PMID&#; S2CID&#;
  25. ^Hayashi G, Hagihara M, Nakatani K (). "Application of L-DNA as a molecular tag". Nucleic Acids Symp Ser (Oxf). 49 (1): – doi/nass/ PMID&#;
  26. ^ abAllemand JF, Bensimon D, Lavery R, Croquette V (). "Stretched and overwound DNA forms a Pauling-like structure with exposed bases". PNAS. 95 (24): – BibcodePNASA. doi/pnas PMC&#; PMID&#;
  27. ^List of 55 fiber structuresArchived at the Wayback Machine
  28. ^Bansal M (). "DNA structure: Revisiting the Watson-Crick double helix". Current Science. 85 (11): –
  29. ^Ghosh A, Bansal M (). "A glossary of DNA structures from A to Z". Acta Crystallogr D. 59 (4): – doi/S PMID&#;
  30. ^Rich A, Norheim A, Wang AH (). "The chemistry and biology of left-handed Z-DNA". Annual Review of Biochemistry. 53: – doi/annurev.bi PMID&#;
  31. ^Sinden, Richard R (). DNA structure and function (1st&#;ed.). Academic Press. p.&#; ISBN&#;.
  32. ^Ho PS (). "The non-B-DNA structure of d(CA/TG)n does not differ from that of Z-DNA". Proc Natl Acad Sci USA. 91 (20): – BibcodePNASH. doi/pnas PMC&#; PMID&#;
  33. ^Wing R, Drew H, Takano T, Broka C, Tanaka S, Itakura K, Dickerson R (). "Crystal structure analysis of a complete turn of B-DNA". Nature. (): –8. BibcodeNaturW. doi/a0. PMID&#; S2CID&#;
  34. ^Stokes, T. D. (). "The double helix and the warped zipper—an exemplary tale". Social Studies of Science. 12 (2): – doi/ PMID&#; S2CID&#;
  35. ^Gautham, N. (25 May ). "Response to 'Variety in DNA secondary structure'"(PDF). Current Science. 86 (10): – Retrieved 25 May [permanent dead link]
  36. ^Protozanova E, Yakovchuk P, Frank-Kamenetskii MD (). "Stacked–Unstacked Equilibrium at the Nick Site of DNA". J Mol Biol. (3): – doi/j.jmb PMID&#;
  37. ^Shimada J, Yamakawa H (). "Ring-Closure Probabilities for Twisted Wormlike Chains. Application to DNA". Macromolecules. 17 (4): – BibcodeMaMolS. doi/maa
  38. ^ abHarrison RM, Romano F, Ouldridge TE, Louis AA, Doye JP (). "Identifying Physical Causes of Apparent Enhanced Cyclization of Short DNA Molecules with a Coarse-Grained Model". Journal of Chemical Theory and Computation. 15 (8): – doi/acs.jctc.9b PMC&#; PMID&#;
  39. ^Travers, Andrew (). "DNA Dynamics: Bubble 'n' Flip for DNA Cyclisation?". Current Biology. 15 (10): R–R doi/j.cub PMID&#; S2CID&#;
  40. ^Konrad MW, Bolonick JW (). "Molecular dynamics simulation of DNA stretching is consistent with the tension observed for extension and strand separation and predicts a novel ladder structure". Journal of the American Chemical Society. (45): – doi/jax.
  41. ^Roe DR, Chaka AM (). "Structural basis of pathway-dependent force profiles in stretched DNA". Journal of Physical Chemistry B. (46): – doi/jpj. PMID&#;
  42. ^Bosaeus N, Reymer A, Beke-Somfai T, Brown T, Takahashi M, Wittung-Stafshede P, Rocha S, Nordén B (). "A stretched conformation of DNA with a biological role?". Quarterly Reviews of Biophysics. 50: e doi/S PMID&#;
  43. ^Taghavi A, van Der Schoot P, Berryman JT (). "DNA partitions into triplets under tension in the presence of organic cations, with sequence evolutionary age predicting the stability of the triplet phase". Quarterly Reviews of Biophysics. 50: e doi/S PMID&#;
  44. ^Crick FH (). "Linking numbers and nucleosomes". Proc Natl Acad Sci USA. 73 (8): – BibcodePNASC. doi/pnas PMC&#; PMID&#;
  45. ^Prunell A (). "A topological approach to nucleosome structure and dynamics: the linking number paradox and other issues". Biophys J. 74 (5): – BibcodeBpJP. doi/S(98) PMC&#; PMID&#;
  46. ^Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ (). "Crystal structure of the nucleosome core particle at A resolution". Nature. (): – BibcodeNaturL. doi/ PMID&#; S2CID&#;
  47. ^Davey CA, Sargent DF, Luger K, Maeder AW, Richmond TJ (). "Solvent mediated interactions in the structure of the nucleosome core particle at Å resolution". Journal of Molecular Biology. (5): – doi/S(02) PMID&#;
Sours: https://en.wikipedia.org/wiki/Nucleic_acid_double_helix

Dna a and b

DNA: Alternative Conformations and Biology

1.

Sinden RR. DNA Structure and FunctionSan Diego: Academic Press, .

2.

Cheatham TEIII, Kollman PA. Insight into the stabilization of A-DNA by specific ion association: spontaneous B-DNA to A-DNA transitions observed in molecular dynamics simulations of d[ACCCGCGGGT]2 in the presence of hexaamminecobalt(III) Structure | – [PubMed: ]

3.

Feig M, Pettitt BM. A molecular simulation picture of DNA hydration around A- and B-DNA. Biopolymers. ;– [PubMed: ]

4.

Egli M. DNA-cation interactions: quo vadis? Chem Biol. ;– [PubMed: ]

5.

Fuller W, Wilkins MHF, Wilson HR. et al. The molecular configuration of deoxyribonucleic acid. IV. X-ray diffraction of the A form. J Mol Biol. ;– [PubMed: ]

6.

Ivanov VI, Minchenkova LE, Minyat EE. et al. The B to A transition of DNA in solution. J Mol Biol. ;– [PubMed: ]

7.

Nishimura Y, Torigoe C, Tsuboi M. Salt induced B-A transition of poly(dG)&#x;poly(dC) and the stabilization of A form by its methylation. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

8.

Ivanov VI, Minchenkova LE. The A-form of DNA: in search of the biological role. Mol Biol (Mosk). ;– Engl Transl [PubMed: ]

9.

Guzikevich-Guerstein G, Shakked Z. A novel form of the DNA double helix imposed on the TATA-box by the TATA-binding protein. Nat Struct Biol. ;– [PubMed: ]

Vargason JM, Henderson K, Ho PS. A crystallographic map of the transition from B-DNA to A-DNA. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Dickerson RE, Ng HL. DNA structure from A to B. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Nekludova L, Pabo CO. Distinctive DNA conformation with enlarged major groove is found in Zn-finger-DNA and other protein-DNA complexes. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Timsit Y. DNA structure and polymerase fidelity. J Mol Biol. ;– [PubMed: ]

Lu XJ, Shakked Z, Olson WK. A-form conformational motifs in ligand-bound DNA structures. J Mol Biol. ;– [PubMed: ]

Flatters D, Young M, Beveridge DL. et al. Conformational properties of the TATA-box binding sequence of DNA. J Biomol Struct Dyn. ;– [PubMed: ]

Barber AM, Zhurkin VB, Adhya S. CRP-binding sites: evidence for two structural classes with 6-bp and 8-bp spacers. Gene. ;–8. [PubMed: ]

Ivanov VI, Minchenkova LE, Chernov BK. et al. CRP-DNA complexes: inducing the A-like form in the binding sites with an extended central spacer. J Mol Biol. ;– [PubMed: ]

Jacobo-Molina A, Ding J, Nanni RG. et al. Crystal structure of human immunodeficiency virus type 1 reverse transcriptase complexed with double-stranded DNA at Å resolution shows bent DNA. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Kiefer JR, Mao C, Braman JC. et al. Visualizing DNA replication in a catalytically active Bacillus DNA polymerase crystal. Nature. ;– [PubMed: ]

Mohr SC, Sokolov NV, He CM. et al. Binding of small acid-soluble spore proteins from Bacillus subtilis changes the conformation of DNA from B to A. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Becker MM, Wang Z. B-A transitions within a 5 S ribosomal RNA gene are highly sequence-specific. J Biol Chem. ;– [PubMed: ]

Vologodskii AV. Topology and Physics of Circular DNABoca Raton: CRC Press, .

Sinden RR, Pettijohn DE. Chromosomes in living Escherichia coli cells are segregated into domains of supercoiling. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Kramer PR, Fragoso G, Pennie W. et al. Transcriptional state of the mouse mammary tumor virus promoter can affect topological domain size in vivo. J Biol Chem. ;– [PubMed: ]

Ljungman M, Hanawalt PC. Presence of negative torsional tension in the promoter region of the transcriptionally poised dihydrofolate reductase gene in vivo. Nucleic Acids Res. ; – [PMC free article: PMC] [PubMed: ]

Jupe ER, Sinden RR, Cartwright IL. Specialized chromatin structure domain boundary elements flanking a Drosophila heat shock gene locus are under torsional strain in vivo. Biochemistry. ;– [PubMed: ]

Kramer PR, Sinden RR. Measurement of unrestrained negative supercoiling and topological domain size in living human cells. Biochemistry. ;– [PubMed: ]

Liu LF, Wang JC. Supercoiling of the DNA template during transcription. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Liu Y, Bondarenko V, Ninfa A. et al. DNA supercoiling allows enhancer action over a large distance. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Horwitz MS, Loeb LA. An E. coli promoter that regulates transcription by DNA superhelix-induced cruciform extrusion. Science. ;– [PubMed: ]

Krajewski WA. Enhancement of transcription by short alternating C&#x;G tracts incorporated within a Rous sarcoma virus-based chimeric promoter: in vivo studies. Mol Gen Genet. ; – [PubMed: ]

Murchie AI, Lilley DM. Supercoiled DNA and cruciform structures. Methods Enzymol. ;– [PubMed: ]

Shlyakhtenko LS, Potaman VN, Sinden RR. et al. Structure and dynamics of supercoil-stabilized DNA cruciforms. J Mol Biol. ;– [PubMed: ]

Schroth GP, Ho PS. Occurrence of potential cruciform and H-DNA forming sequences in genomic DNA. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

Pearson CE, Zorbas H, Price GB. et al. Inverted repeats, stem-loops, and cruciforms: significance for initiation of DNA replication. J Cell Biochem. ;– [PubMed: ]

Cox R, Mirkin SM. Characteristic enrichment of DNA repeats in different genomes. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Herbert A, Rich A. Left-handed Z-DNA: structure and function. Genetica. ;– [PubMed: ]

Schroth GP, Chou PJ, Ho PS. Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. J Biol Chem. ;– [PubMed: ]

Wells RD, Collier DA, Hanvey JC. et al. The chemistry and biology of unusual DNA structures adopted by oligopurine&#x;oligopyrimidine sequences. FASEB J. ;– [PubMed: ]

Htun H, Dahlberg JE. Topology and formation of triple-stranded H-DNA. Science. ;– [PubMed: ]

Frank-Kamenetskii MD, Mirkin SM. Triplex DNA structures. Annu Rev Biochem. ;– [PubMed: ]

Soyfer VN, Potaman VN. . Triple-Helical Nucleic Acids. New York: Springer.

Lyamichev VI, Mirkin SM, Frank-Kamenetskii MD. Structures of homopurine-homopyrimidine tract in superhelical DNA. J Biomol Struct Dyn. ;– [PubMed: ]

Kohwi Y, Kohwi-Shigematsu T. Magnesium ion-dependent triple-helix structure formed by homopurine-homopyrimidine sequences in supercoiled plasmid DNA. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Potaman VN, Sinden RR. Stabilization of intramolecular triple/single-strand structure by cationic peptides. Biochemistry. ;– [PubMed: ]

Tiner WJSr, Potaman VN, Sinden RR. et al. The structure of intramolecular triplex DNA: atomic force microscopy study. J Mol Biol. ;– [PubMed: ]

McClellan JA, Boublikova P, Palecek E. et al. Superhelical torsion in cellular DNA responds directly to environmental and genetic factors. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Rahmouni AR, Wells RD. Stabilization of Z DNA in vivo by localized supercoiling. Science. ;– [PubMed: ]

Karlovsky P, Pecinka P, Vojtiskova M. et al. Protonated triplex DNA in E. coli cells as detected by chemical probing. FEBS Lett. ;– [PubMed: ]

Zheng GX, Kochel T, Hoepfner RW. et al. Torsionally tuned cruciform and Z-DNA probes for measuring unrestrained supercoiling at specific sites in DNA of living cells. J Mol Biol. ;– [PubMed: ]

Ussery DW, Sinden RR. Environmental influences on the in vivo level of intramolecular triplex DNA in Escherichia coli. Biochemistry. ;– [PubMed: ]

Kohwi Y, Malkhosyan SR, Kohwi-Shigematsu T. Intramolecular dG&#x;dG&#x;dC triplex detected in Escherichia coli cells. J Mol Biol. ;– [PubMed: ]

Haniford DB, Pulleyblank DE. The in vivo occurrence of Z DNA. J Biomol Struct Dyn. ;– [PubMed: ]

Haniford DB, Pulleyblank DE. Transition of a cloned d(AT)n-d(AT)n tract to a cruciform in vivo. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

Jaworski A, Hsieh WT, Blaho JA. et al. Left-handed DNA in vivo. Science. ;– [PubMed: ]

Lukomski S, Wells RD. Left-handed Z-DNA and in vivo supercoil density in the Escherichia coli chromosome. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Ward GK, Shihab-el-Deen A, Zannis-Hadjopoulos M. et al. DNA cruciforms and the nuclear supporting structure. Exp Cell Res. ;– [PubMed: ]

Nordheim A, Lafer EM, Peck LJ. et al. Negatively supercoiled plasmids contain left-handed Z-DNA segments as detected by specific antibody binding. Cell. ;– [PubMed: ]

Agazie YM, Burkholder GD, Lee JS. Triplex DNA in the nucleus: direct binding of triplex-specific antibodies and their effect on transcription, replication and cell growth. Biochem J. ;(Pt 2)– [PMC free article: PMC] [PubMed: ]

Sharples GJ. The X philes: structure-specific endonucleases that resolve Holliday junctions. Mol Microbiol. ;– [PubMed: ]

Constantinou A, Chen XB, McGowan CH. et al. Holliday junction resolution in human cells: two junction endonucleases with distinct substrate specificities. EMBO J. ;– [PMC free article: PMC] [PubMed: ]

Kim YG, Muralinath M, Brandt T. et al. A role for Z-DNA binding in vaccinia virus pathogenesis. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Li G, Tolstonog GV, Traub P. Interaction in vitro of type III intermediate filament proteins with Z-DNA and B-Z-DNA junctions. DNA Cell Biol. ;– [PubMed: ]

Kiyama R, Camerini-Otero RD. A triplex DNA-binding protein from human cells: purification and characterization. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Guieysse AL, Praseuth D, Helene C. Identification of a triplex DNA-binding protein from human cells. J Mol Biol. ;– [PubMed: ]

Ciotti P, Van DykeMW, Bianchi-Scarra G. et al. Characterization of a triplex DNA-binding protein encoded by an alternative reading frame of loricrin. Eur J Biochem. ;– and references therein. [PubMed: ]

Hildebrandt M, Lacombe ML, Mesnildrey S. et al. A human NDP-kinase B specifically binds single-stranded poly-pyrimidine sequences. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

Brunel F, Zakin MM, Buc H. et al. The polypyrimidine tract binding (PTB) protein interacts with single-stranded DNA in a sequence-specific manner. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

Farokhzad OC, Teodoridis JM, Park H. et al. CD43 gene expression is mediated by a nuclear factor which binds pyrimidine-rich single-stranded DNA. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

Wang JC, Lynch AS. Transcription and DNA supercoiling. Curr Opin Genet Dev. ;– [PubMed: ]

Kato M, Shimizu N. Effect of the potential triplex DNA region on the in vitro expression of bacterial ²-lactamase gene in superhelical recombinant plasmids. J Biochem. ;– [PubMed: ]

Simpson RT. Nucleosome positioning: occurrence, mechanisms, and functional consequences. Prog Nucleic Acid Res Mol Biol. ;– [PubMed: ]

Nickol J, Martin RG. DNA stem-loop structures bind poorly to histone octamer cores. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Casasnovas JM, Azorin F. Supercoiled induced transition to the Z-DNA conformation affects the ability of a d(CG/GC)12 sequence to be organized into nucleosome-cores. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

Westin L, Blomquist P, Milligan JF. et al. Triple helix DNA alters nucleosomal histone-DNA interactions and acts as a nucleosome barrier. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

Laundon CH, Griffith JD. Curved helix segments can uniquely orient the topology of supertwisted DNA. Cell. ;– [PubMed: ]

Kohwi Y, Panchenko Y. Transcription-dependent recombination induced by triple-helix formation. Genes Dev. ;– [PubMed: ]

Rooney SM, Moore PD. Antiparallel, intramolecular triplex DNA stimulates homologous recombination in human cells. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Shlyakhtenko LS, Hsieh P, Grigoriev M. et al. A cruciform structural transition provides a molecular switch for chromosome structure and dynamics. J Mol Biol. ;– [PubMed: ]

Soldatenkov VA, Chasovskikh S, Potaman VN. et al. Transcriptional repression by binding of poly(ADP-ribose) polymerase to promoter sequences. J Biol Chem. ;– [PubMed: ]

Oei SL, Herzog H, Hirsch-Kauffmann M. et al. Transcriptional regulation and autoregulation of the human gene for ADP-ribosyltransferase. Mol Cell Biochem. ;– [PubMed: ]

Spiro C, McMurray CT. Switching of DNA secondary structure in proenkephalin transcriptional regulation. J Biol Chem. ;– [PubMed: ]

Bedinger P, Munn M, Alberts BM. Sequence-specific pausing during in vitro DNA replication on double-stranded DNA templates. J Biol Chem. ;– [PubMed: ]

Hacker JK, Alberts BM. The rapid dissociation of the T4 DNA polymerase holoenzyme when stopped by a DNA hairpin helix. A model for polymerase release following the termination of each Okazaki fragment. J Biol Chem. ;– [PubMed: ]

Baran N, Lapidot A, Manor H. Formation of DNA triplexes accounts for arrests of DNA synthesis at d(TC)n and d(GA)n tracts. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Dayn A, Samadashwily GM, Mirkin SM. Intramolecular DNA triplexes: unusual sequence requirements and influence on DNA polymerization. Proc Natl Acad Sci USA. ;– [PMC free article: PMC] [PubMed: ]

Potaman VN, Bissler JJ. Overcoming a barrier for DNA polymerization in triplex-forming sequences. Nucleic Acids Res. ;e5. [PMC free article: PMC] [PubMed: ]

Kopel V, Pozner A, Baran N. et al. Unwinding of the third strand of a DNA triple helix, a novel activity of the SV40 large T-antigen helicase. Nucleic Acids Res. ;– [PMC free article: PMC] [PubMed: ]

Liu G, Malott M, Leffak M. Multiple functional elements comprise a mammalian chromosomal replicator. Mol Cell Biol. ;– [PMC free article: PMC] [PubMed: ]

Blaho JA, Wells RD. Left-handed Z-DNA and genetic recombination. Prog Nucleic Acid Res Mol Biol. ;– [PubMed: ]

Pearson CE, Sinden RR. Trinucleotide repeat DNA structures: dynamic mutations from dynamic DNA. Curr Opin Struct Biol. ;– [PubMed: ]

Sinden RR, Potaman VN, Oussatcheva EA. et al. Triplet repeat DNA structures and human genetic disease: dynamic mutations from dynamic DNA. J Biosci. ;27(Suppl 1)– [PubMed: ]

Streisinger G, Okada Y, Emrich J. et al. Frameshift mutations and the genetic code. Cold Spring Harb Symp Quant Biol. ;– [PubMed: ]

Ripley LS. Frameshift mutation: determinants of specificity. Annu Rev Genet. ;– [PubMed: ]

Sinden RR, Wells RD. DNA structure, mutations, and human genetic disease. Curr Opin Biotechnol. ;– [PubMed: ]

Strauss BS. Frameshift mutation, microsatellites and mismatch repair. Mutat Res. ; – [PubMed: ]

Miller CA, Umek RM, Kowalski D. The inefficient replication origin from yeast ribosomal DNA is naturally impaired in the ARS consensus sequence and in DNA unwinding. Nucleic Acids Res. ;– and references therein. [PMC free article: PMC] [PubMed: ]

Berberich S, Trivedi A, Daniel DC. et al. In vitro replication of plasmids containing human c-myc DNA. J Mol Biol. ;– [PubMed: ]

Potaman VN, Bissler JJ, Hashem VI. et al. Unpaired structures in SCA10 (ATTCT)n&#x;(AGAAT)n repeats. J Mol Biol. ;– [PubMed: ]

Sours: https://www.ncbi.nlm.nih.gov/books/NBK/
EVOLVE DNA 75 jacvapour series B upgrade for larger tanks

They devoured me with their eyes. There was only one word in their eyes - slut. Looking into their eyes, I finished.

You will also be interested:

My nerves are on edge, I do not know how he will behave when he comes up, what he says. IS HE. I feel that this is it. He comes up from behind, runs his hand along my half-naked back, bends down to my neck, I feel his breath on my skin, kisses.



33338 33339 33340 33341 33342